miRBase entry: gma-MIR5772

Stem-loop gma-MIR5772


Accession
MI0019719
Description
Glycine max gma-MIR5772 precursor miRNA


Sequence


gucgcaagcaAGAAUGUGAGUUAGAGUGAGCAUCccuaaaaaaagaauuucaaauucuauauuuuugagagaauuugaaaucccacuauuuuagucugucgcaaccuaccuuacgacg
((((.(((..((..(((((..((((.((((.....((......)).((((((((((((.((....))..))))))))))))........)))).)))))))))..))..))).)))).

Structure
-    c   ca  AA     GU    G    CAUCccuaaaaaaaga            -a  u 
 gucg aag  AG  UGUGA  UAGA UGAG                auuucaaauucu  ua u
 |||| |||  ||  |||||  |||| ||||                ||||||||||||  ||  
 cagc uuc  uc  acgcu  gucu auuu                uaaaguuuaaga  gu u
g    a   ca  ca     --    g    --------uaucaccc            ga  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr3: 19529805-19529922 [-]

Database links

Mature gma-miR5772

Accession MIMAT0023174
Description Glycine max gma-miR5772 mature miRNA
Sequence 11 - AGAAUGUGAGUUAGAGUGAGCAUC - 34
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553