miRBase entry: gma-MIR171o

Stem-loop gma-MIR171o


Accession
MI0019749
Description
Glycine max gma-MIR171o precursor miRNA

Literature search
16 open access papers mention gma-MIR171o
(37 sentences)

Sequence


uaagggcuugAGAUAUUGGUACGGUUCAAUCagaagacagugcuuuaugauucuaaagcucucuuauuugaUUGAGCCGUGCCAAUAUCACAugcaaacuuu
.....((.((.(((((((((((((((((((((((.((.((.((((((......)))))).)).)).))))))))))))))))))))))).)).)).......

Structure
--uaagg  u  A                       a  c  u      ug 
       gc ug GAUAUUGGUACGGUUCAAUCaga ga ag gcuuua  a
       || || ||||||||||||||||||||||| || || ||||||   
       cg AC CUAUAACCGUGCCGAGUUaguuu uu uc cgaaau  u
uuucaaa  u  A                       a  c  u      cu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr13: 31863180-31863281 [+]

Database links

Mature gma-miR171o-3p

Accession MIMAT0023204
Description Glycine max gma-miR171o-3p mature miRNA
Sequence 72 - UUGAGCCGUGCCAAUAUCACA - 92
Evidence experimental
Illumina [1]

Mature gma-miR171o-5p

Accession MIMAT0032131
Description Glycine max gma-miR171o-5p mature miRNA
Sequence 11 - AGAUAUUGGUACGGUUCAAUC - 31
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  2. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153