miRBase entry: gma-MIR399c

Stem-loop gma-MIR399c


Accession
MI0019773
Description
Glycine max gma-MIR399c precursor miRNA

Literature search
14 open access papers mention gma-MIR399c
(90 sentences)

Sequence


aaaccagcuauagggcuucucuuuauuggcaggaaauuaucaugaccacuucaucagauaucuUGCCAAAGGAGAGUUGCCCUGuugcugcuuu
....((((.(((((((..((((((.(((((((((...((((.(((........)))))))))))))))).))))))..))))))).))))....

Structure
aaac    u       uu      a         aau    a   cca 
    cagc auagggc  cucuuu uuggcagga   uauc uga   c
    |||| |||||||  |||||| |||||||||   |||| |||    
    gucg uGUCCCG  GAGAGG AACCGUucu   auag acu   u
uuuc    u       UU      A         ---    -   acu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr20: 39360463-39360556 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from gma-MIR399c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature gma-miR399c

Accession MIMAT0023228
Description Glycine max gma-miR399c mature miRNA
Sequence 64 - UGCCAAAGGAGAGUUGCCCUG - 84
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553