miRBase entry: hhv6b-mir-Ro6-4

Stem-loop hhv6b-mir-Ro6-4


Accession
MI0020182
Description
Human herpesvirus 6B hhv6b-mir-Ro6-4 precursor miRNA


Sequence


gaccgagcggCGGAUGGAGCCCGCUCGGUCUCGcacguccgcgAUACCGAGCGGACUCCGUCGCCgcuccgg
..((((((((((.((((((.(((((((((.((((......)))).))))))))).))))))))))))).)))

Structure
ga   -       G      C         C    ac 
  ccg agcggCG AUGGAG CCGCUCGGU UCGc  g
  ||| ||||||| |||||| ||||||||| ||||   
  ggc ucgCCGC UGCCUC GGCGAGCCA Agcg  u
--   c       -      A         U    cc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature hhv6b-miR-Ro6-4-5p

Accession MIMAT0026462
Description Human herpesvirus 6B hhv6b-miR-Ro6-4-5p mature miRNA
Sequence 11 - CGGAUGGAGCCCGCUCGGUCUCG - 33
Evidence experimental
cloned [1]

Mature hhv6b-miR-Ro6-4-3p

Accession MIMAT0026463
Description Human herpesvirus 6B hhv6b-miR-Ro6-4-3p mature miRNA
Sequence 44 - AUACCGAGCGGACUCCGUCGCC - 65
Evidence experimental
cloned [1]

References

  1. PubMed ID: 22114334
    Small RNA deep sequencing identifies microRNAs and other small noncoding RNAs from human herpesvirus 6B
    "Tuddenham L, Jung JS, Chane-Woon-Ming B, Dolken L, Pfeffer S"
    "J Virol (2012) 86:1638-1649