Stem-loop bta-mir-6123

Accession

MI0021141

Description

Bos taurus bta-mir-6123 precursor miRNA

Literature search

1 open access papers mention bta-mir-6123
(1 sentences)

Sequence

651 reads, 21 reads per million, 63 experiments

agccugcUGCCAAGCCCACGUUCAAAGGcuguuucuucaaaguuaauggugccgccuuugagcugggaagggaagcgggcag
.(((((((.((...((((.((((((((((.((.((............)).)).))))))))))))))...)).)))))))..

Structure

-a       G  AAG    C          u  u  uucaa 
  gccugcU CC   CCCA GUUCAAAGGc gu uc     a
  ||||||| ||   |||| |||||||||| || ||      
  cgggcga gg   gggu cgaguuuccg cg gg     g
ga       a  gaa    -          c  u  uaauu 

Annotation confidence Not enough data

Genome context

chr13: 58332856-58332937 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from bta-mir-6123

Mature bta-miR-6123

• Accession: MIMAT0024596
• Description: Bos taurus bta-miR-6123 mature miRNA
• Sequence: 8 - UGCCAAGCCCACGUUCAAAGG - 28
• Evidence: experimental ; Illumina [1-3]

References

1. PubMed ID: 21912509
   Solexa sequencing of novel and differentially expressed microRNAs in testicular and ovarian tissues in Holstein cattle
   "Huang J, Ju Z, Li Q, Hou Q, Wang C, Li J, Li R, Wang L, Sun T, Hang S, Gao Y, Hou M, Zhong J"
   "Int J Biol Sci (2011) 7:1016-1026


2. PubMed ID: 22298343
   Deep sequencing reveals predominant expression of miR-21 amongst the small non-coding RNAs in retinal microvascular endothelial cells
   Guduric-Fuchs J, O'Connor A, Cullen A, Harwood L, Medina RJ, O'Neill CL, Stitt AW, Curtis TM, Simpson DA
   J Cell Biochem (2012) 113:2098-2111


3. PubMed ID: 23100578
   Profiling of differentially expressed microRNA and the bioinformatic target gene analyses in bovine fast- and slow-type muscles by massively parallel sequencing
   "Muroya S, Taniguchi M, Shibata M, Oe M, Ojima K, Nakajima I, Chikuni K"
   "J Anim Sci (2013) 91:90-103