miRBase entry: rno-mir-6319-1

Stem-loop rno-mir-6319-1


Accession
MI0021841
Description
Rattus norvegicus rno-mir-6319-1 precursor miRNA


Sequence

427 reads, 1 reads per million, 178 experiments
ucagaaauacucagcaguguuagaggagcuggauucacagggcaguggagaugccgagaggaaugagccuuUCAUUCUCGCUGCUCUGGAGUccugcucuucaguuucuucaucggcagagugaaca
.......(((((.((.(((...(((((((.((((((.((((((((((.(((....((((((......))))))..))))))))))))))))))).)))))))........)))..)).)))))....

Structure
ucagaaa     a  -a   -----uua       u      a          g   ugcc      aa 
       uacuc gc  gug        gaggagc ggauuc cagggcagug aga    gagagg  u
       ||||| ||  |||        ||||||| |||||| |||||||||| |||    ||||||   
       gugag cg  uac        cuucucg ccUGAG GUCUCGUCGC UCU    CUuucc  g
---acaa     a  gc   uucuuuga       u      -          -   --UA      ga 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr17: 34746552-34746678 [+]

Database links

Mature rno-miR-6319

Accession MIMAT0025056
Description Rattus norvegicus rno-miR-6319 mature miRNA
Sequence 72 - UCAUUCUCGCUGCUCUGGAGU - 92
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22605339
    Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum
    "Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T"
    "J Biol Chem (2012) 287:24397-24411

  2. PubMed ID: 22908386
    MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase
    "Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC"
    "J Biol Chem (2012) 287:25312-25324