miRBase entry: rno-mir-6321

Stem-loop rno-mir-6321


Accession
MI0021844
Description
Rattus norvegicus rno-mir-6321 precursor miRNA


Sequence

2448 reads, 4 reads per million, 222 experiments
ucgaguguugaagucucagguagcagugcucaugggucucUACUGCAGUGAGUUCUAUGAAGCcucagguagcagugcucaugggucucuauugcagugaguucuaugaagccaaugcucucaugauggaagaagaaggcg
....((.((....(((((((.((((..(((((((((.(((.(((((((((((.(((((((.((((........)).))))))))).))).))))))))))).)))))).)))...)))).)).)))..)).....)).)).

Structure
ucga  g  -gaag  --   -  u    -gu   -      u   U        -   U       A  -  cag 
    gu uu     uc  uca gg agca   gcu cauggg cuc ACUGCAGU GAG UCUAUGA GC cu   g
    || ||     ||  ||| || ||||   ||| |||||| ||| |||||||| ||| ||||||| || ||    
    cg aa     ag  agu cu ucgu   cga guaucu gag ugacguua cuc ggguacu cg ga   u
---g  g  gaaga  gu   a  c    aac   a      u   -        u   u       -  u  cga 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr14: 21097338-21097478 [-]

Database links

Mature rno-miR-6321

Accession MIMAT0025059
Description Rattus norvegicus rno-miR-6321 mature miRNA
Sequence 41 - UACUGCAGUGAGUUCUAUGAAGC - 63
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22605339
    Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum
    "Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T"
    "J Biol Chem (2012) 287:24397-24411

  2. PubMed ID: 22908386
    MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase
    "Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC"
    "J Biol Chem (2012) 287:25312-25324