miRBase entry: rno-mir-6328

Stem-loop rno-mir-6328


Accession
MI0021852
Description
Rattus norvegicus rno-mir-6328 precursor miRNA


Sequence

3198 reads, 7 reads per million, 359 experiments
gagugcucuggugggaggggggagggcccagagcagcgguucugcugggcucucagAGGCCUGCUCUGAGCCCCCGCcuccuccuucucagccuccc
(((.(((..((.((((((((((.((((.((((((((.(.(((((..(....).))))).))))))))).)))).).))))))))).)).))))))..

Structure
--   u   cu  u         - a    c        c g     cu g 
  gag gcu  gg gggaggggg g gggc cagagcag g uucug  g g
  ||| |||  || ||||||||| | |||| |||||||| | |||||  |  
  cuc cga  uc uccuccucC C CCCG GUCUCGUC C GAgac  c c
cc   -   -c  u         G C    A        - G     -u u 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr20: 3394813-3394909 [+]

Database links

Mature rno-miR-6328

Accession MIMAT0025067
Description Rattus norvegicus rno-miR-6328 mature miRNA
Sequence 57 - AGGCCUGCUCUGAGCCCCCGC - 77
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22605339
    Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum
    "Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T"
    "J Biol Chem (2012) 287:24397-24411

  2. PubMed ID: 22908386
    MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase
    "Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC"
    "J Biol Chem (2012) 287:25312-25324