miRBase entry: rno-mir-3072

Stem-loop rno-mir-3072


Accession
MI0021856
Description
Rattus norvegicus rno-mir-3072 precursor miRNA

Literature search
1 open access papers mention rno-mir-3072
(1 sentences)

Sequence

453 reads, 2 reads per million, 108 experiments
ccaagaagguggcagggcugugagugugagggaccccgagggagggcaggcugccccaggcccUGCCCCCUCCAGGAAGCCUUCUUgcuccagccccacacacgaucucaa
...(((..((((..((((((.((((..(((((...((..(((.(((((((..(((...)))))))))).)))..))...)))))..))))))))))..).)))..)))...

Structure
cca   ag   - ca      u    gu     acc  ga   a       cu   c 
   aga  gug g  gggcug gagu  gaggg   cc  ggg gggcagg  gcc  
   |||  ||| |  |||||| ||||  |||||   ||  ||| |||||||  ||| c
   ucu  cac c  cccgac cucg  CUUCC   GG  CUC CCCGUcc  cgg  
aac   ag   a ac      -    UU     GAA  AC   C       --   a 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chr6: 133898795-133898905 [+]
Clustered miRNAs
9 other miRNAs are < 10 kb from rno-mir-3072
Name Accession Chromosome Start End Strand Confidence




Database links

Mature rno-miR-3072

Accession MIMAT0025071
Description Rattus norvegicus rno-miR-3072 mature miRNA
Sequence 64 - UGCCCCCUCCAGGAAGCCUUCUU - 86
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22605339
    Limonoid compounds inhibit sphingomyelin biosynthesis by preventing CERT protein-dependent extraction of ceramides from the endoplasmic reticulum
    "Hullin-Matsuda F, Tomishige N, Sakai S, Ishitsuka R, Ishii K, Makino A, Greimel P, Abe M, Laviad EL, Lagarde M, Vidal H, Saito T, Osada H, Hanada K, Futerman AH, Kobayashi T"
    "J Biol Chem (2012) 287:24397-24411

  2. PubMed ID: 22908386
    MicroRNAs in the pineal gland: miR-483 regulates melatonin synthesis by targeting arylalkylamine N-acetyltransferase
    "Clokie SJ, Lau P, Kim HH, Coon SL, Klein DC"
    "J Biol Chem (2012) 287:25312-25324