Accession
MI0022279
Description
Bos taurus
bta-mir-378b precursor miRNA
Gene family
MIPF0000168;
mir-378
Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?
Bta-mir-378b is a down-regulated microRNA in multiple intestinal regions of super-shedding (SS) cattle, suggesting its potential role in altering lipid metabolism and immune functions in the intestinal tract [PMC7959717]. It is a member of the miR-378 gene family, which has been implicated in regulating lipogenesis in adipose tissues [PMC7959717]. In the recto-anal junction (RAJ), bta-mir-378b is negatively correlated with PRDM1 and CYLD, genes associated with humoral and cell-mediated immune responses [PMC7959717]. In all intestinal regions, the target transcripts negatively correlated with bta-mir-378b are enriched for immune functions [PMC7959717'>PMC7959717'>PMC7959717'>PMC7959717'>PMC7959717]. It is worth investigating whether bta-mir-378b directly targets immune-related genes or regulates immune functions through lipid metabolism [PMC7959717]. The down-regulation of bta-mir-378b is associated with an increased expression of PRDM1 and CYLD in RAJ, which may be influenced by translocation of Gram-negative bacteria when the host intestinal mucosal barrier is disrupted or immune defenses are deficient [PMC7959717]. Bta-mir-378b down-regulation suggests its important role in E. coli O157 super-shedding [PMC7959717]. In the distal jejunum, several transcripts are negatively correlated with bta-miR-18a, bta-mir-378b, and bta-miR-2284d between non-super-shedding (NS) and SS cattle. These transcripts are associated with cell-mediated immune responses and hematological system development [PMC7959717]. Bta-mir-378b is down-regulated across all intestinal regions of SS cattle, indicating its potential significance in E. coli O157 super-shedding [PMC7959717].
Literature search
24 open access papers mention bta-mir-378b
(101 sentences)
(101 sentences)
Sequence
914
reads,
286
reads per million, 67 experiments
cuggaccaccagggaaauccugauuuuguuucuuauuaaggggagguucaguauagagcaaacagcACUUGACUUGGAGUCAGAAGGCuuagguccaa
.((((((..((((.....)))).(((((((((...((((((....((((......))))......).)))))...)))).)))))......)))))).
.((((((..((((.....)))).(((((((((...((((((....((((......))))......).)))))...)))).)))))......)))))).
Structure
c accagggaaauccuga - uua - --ggag ag uggacc uuuug uuuc uuaag g guuc u |||||| ||||| |||| ||||| | |||| accugg AAGAC GAGG AGUUC c cgag a a ----------auuCGG U UUC A gacaaa au
Annotation confidence
Not enough data
Do you think this miRNA is real?
Genome context
chr15: 30904740-30904837 [+]
Database links
Mature bta-miR-378b
| Accession | MIMAT0025535 |
| Description | Bos taurus bta-miR-378b mature miRNA |
| Sequence | 67 - ACUUGACUUGGAGUCAGAAGGC - 88 |
| Evidence |
experimental
Illumina [1] |
References
|
