WARNING: This summary was generated by AI. Bta-mir-378b, a member of the miR-378 gene family, is implicated in regulating lipogenesis in adipose tissues and is down-regulated in multiple intestinal regions of super-shedders (SS), suggesting a role in altering lipid metabolism and immune functions, potentially affecting E. coli O157 interactions [PMC7959717]. This miRNA's down-regulation correlates with the negative regulation of PRDM1 and CYLD transcripts, which are associated with immune responses [PMC7959717]. The breadth of bta-mir-378b's influence is evident as it is down-regulated across all intestinal regions examined in SS cattle, with a varying number of negatively correlated transcripts ranging from two to 38 [PMC7959717]. The down-regulation pattern suggests bta-mir-378b may influence the expression of genes involved in immune defenses potentially affected by translocation of Gram-negative bacteria [PMC7959717]. Furthermore, bta-mir-378b's role as a key regulator is underscored by its consistent down-regulation across all intestinal regions studied and its association with differentially expressed genes between non-shedders (NS) and SS cattle [PMC7959717].
c accagggaaauccuga - uua - --ggag ag uggacc uuuug uuuc uuaag g guuc u |||||| ||||| |||| ||||| | |||| accugg AAGAC GAGG AGUUC c cgag a a ----------auuCGG U UUC A gacaaa au
| Accession | MIMAT0025535 |
| Description | Bos taurus bta-miR-378b-3p mature miRNA |
| Sequence | 67 - ACUUGACUUGGAGUCAGAAGGC - 88 |
| Evidence |
experimental
Illumina [1] |
|