miRBase entry: mdm-MIR167a

Stem-loop mdm-MIR167a


Accession
MI0023026
Description
Malus domestica mdm-MIR167a precursor miRNA

Literature search
11 open access papers mention mdm-MIR167a
(237 sentences)

Sequence


ucaugcacugguagcgguugaagcugccagcaugaucuuauaacucccwacuucguuuagggaagaucAGAUCAUCUGGCAGUUUCACCuguuacugguagcauga
(((((((((((((((((.((((((((((((.(((((((.((...((((...........))))..)).))))))))))))))))))).))))))))))).))))))

Structure
      -           u            c       u  aac    wacu 
ucaugc acugguagcgg ugaagcugccag augaucu au   uccc    u
|||||| ||||||||||| |||||||||||| ||||||| ||   ||||    c
aguacg uggucauuguC ACUUUGACGGUC UACUAGA ua   aggg    g
      a           C            -       c  -ga    auuu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
MDC002483.224: 612-717 [+]

Database links

Mature mdm-miR167a

Accession MIMAT0025922
Description Malus domestica mdm-miR167a mature miRNA
Sequence 69 - AGAUCAUCUGGCAGUUUCACC - 89
Evidence experimental
miRNAseq [1]

References

  1. PubMed ID: 22704043
    Apple miRNAs and tasiRNAs with novel regulatory networks
    Xia R, Zhu H, An YQ, Beers EP, Liu Z
    Genome Biol (2012) 13:R47