miRBase entry: mdm-MIR393b

Stem-loop mdm-MIR393b


Accession
MI0023080
Description
Malus domestica mdm-MIR393b precursor miRNA

Literature search
6 open access papers mention mdm-MIR393b
(31 sentences)

Sequence


gguggaggcuUCCAAAGGGAUCGCAUUGAUCUaauugaucagauaugucaaacaucauccgcauagacauaugguggguuauguuuucgucuguguagucggaucaugcgaucccuucggacguuuccauc
(((((((((.(((.((((((((((((.(((((.((((..(((((.....((((((.(((((((((....))).)))))).))))))..)))))..)))).))))))))))))))))).))).)))))))))

Structure
         u   A            U     a    au     auguc      c      -   g 
gguggaggc UCC AAGGGAUCGCAU GAUCU auug  cagau     aaacau auccgc aua a
||||||||| ||| |||||||||||| ||||| ||||  |||||     |||||| |||||| |||  
cuaccuuug agg uucccuagcgua cuagg ugau  gucug     uuugua ugggug uau c
         c   c            -     c    gu     ---cu      u      g   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
MDC005391.194: 11328-11458 [+]

Database links

Mature mdm-miR393b

Accession MIMAT0025976
Description Malus domestica mdm-miR393b mature miRNA
Sequence 11 - UCCAAAGGGAUCGCAUUGAUCU - 32
Evidence experimental
miRNAseq [1]

References

  1. PubMed ID: 22704043
    Apple miRNAs and tasiRNAs with novel regulatory networks
    Xia R, Zhu H, An YQ, Beers EP, Liu Z
    Genome Biol (2012) 13:R47