miRBase entry: ccr-mir-25

Stem-loop ccr-mir-25


Accession
MI0023381
Description
Cyprinus carpio ccr-mir-25 precursor miRNA

Literature search
2 open access papers mention ccr-mir-25
(2 sentences)

Sequence


uagcugguguugagaggcggagacuugggcaguugcuggcuuucccacaaggCAUUGCACUUGUCUCGGUCUGAcagugccggcacaacucaucu
..((((((((((..((((.(((((..(.(((((.(((((.....))....)))))))).)..))))).))))..))))))))))...........

Structure
---------ua          ag    g     uu g     u   ----  c 
           gcugguguug  aggc gagac  g gcagu gcu    gg u
           ||||||||||  |||| |||||  | ||||| |||    || u
           cggccgugac  UCUG CUCUG  C CGUUA Cgg    cc u
ucuacucaaca          AG    G     UU A     -   aaca  c 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature ccr-miR-25

Accession MIMAT0026280
Description Cyprinus carpio ccr-miR-25 mature miRNA
Sequence 53 - CAUUGCACUUGUCUCGGUCUGA - 74
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 22303472
    Identification and profiling of microRNAs from skeletal muscle of the common carp
    Yan X, Ding L, Li Y, Zhang X, Liang Y, Sun X, Teng CB
    PLoS One (2012) 7:e30925