miRBase entry: mml-mir-7183

Stem-loop mml-mir-7183


Accession
MI0023668
Description
Macaca mulatta mml-mir-7183 precursor miRNA


Sequence

334 reads, 3 reads per million, 5 experiments
UGAAUUGGUAUUGCAAAUGACAuguaugcaaauugGCAUUUGCAUUACCAAUACACA
((.(((((((.((((((((.((...........)).)))))))).))))))).))..

Structure
--  A       U        A  ugua 
  UG AUUGGUA UGCAAAUG CA    u
  || ||||||| |||||||| ||    g
  AC UAACCAU ACGUUUAC gu    c
AC  A       U        G  uaaa 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 10378454-10378510 [+]

Database links

Mature mml-miR-7183-5p

Accession MIMAT0028318
Description Macaca mulatta mml-miR-7183-5p mature miRNA
Sequence 1 - UGAAUUGGUAUUGCAAAUGACA - 22
Evidence experimental
Illumina [1]

Mature mml-miR-7183-3p

Accession MIMAT0028319
Description Macaca mulatta mml-miR-7183-3p mature miRNA
Sequence 36 - GCAUUUGCAUUACCAAUACACA - 57
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45