miRBase entry: mdo-mir-7249

Stem-loop mdo-mir-7249


Accession
MI0023744
Description
Monodelphis domestica mdo-mir-7249 precursor miRNA


Sequence

58 reads, 1 reads per million, 4 experiments
GUUGGUACUGUCUCUCUCAUUuuugcuucucugaaUGGGAAAAACAGUAUCUUCUC
(..((((((((...((((((((..........))))))))...))))))))..)..

Structure
-- UU        CUC        uugc 
  G  GGUACUGU   UCUCAUUu    u
  |  ||||||||   ||||||||     
  C  CUAUGACA   AGGGUaag    u
CU UU        AAA        ucuc 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1: 699814288-699814343 [+]

Database links

Mature mdo-miR-7249-5p

Accession MIMAT0028464
Description Monodelphis domestica mdo-miR-7249-5p mature miRNA
Sequence 1 - GUUGGUACUGUCUCUCUCAUU - 21
Evidence experimental
Illumina [1]

Mature mdo-miR-7249-3p

Accession MIMAT0028465
Description Monodelphis domestica mdo-miR-7249-3p mature miRNA
Sequence 36 - UGGGAAAAACAGUAUCUUCUC - 56
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45