miRBase entry: mdo-mir-7256

Stem-loop mdo-mir-7256


Accession
MI0023751
Description
Monodelphis domestica mdo-mir-7256 precursor miRNA


Sequence

12 reads, 1 reads per million, 1 experiments
CGUUUCCUCUUUUCAGCCCACGgguggguuugUGGGCCAAAGAGAAGAAACGAU
((((((.((((((..((((((((......))))))))..)))))).))))))..

Structure
--      C      CA        gu 
  CGUUUC UCUUUU  GCCCACGg  g
  |||||| ||||||  ||||||||   
  GCAAAG AGAGAA  CGGGUguu  g
UA      A      AC        ug 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr1: 3445803-3445856 [+]

Database links

Mature mdo-miR-7256-5p

Accession MIMAT0028478
Description Monodelphis domestica mdo-miR-7256-5p mature miRNA
Sequence 1 - CGUUUCCUCUUUUCAGCCCACG - 22
Evidence experimental
Illumina [1]

Mature mdo-miR-7256-3p

Accession MIMAT0028479
Description Monodelphis domestica mdo-miR-7256-3p mature miRNA
Sequence 33 - UGGGCCAAAGAGAAGAAACGAU - 54
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45