miRBase entry: mdo-mir-7266

Stem-loop mdo-mir-7266


Accession
MI0023767
Description
Monodelphis domestica mdo-mir-7266 precursor miRNA


Sequence

218 reads, 53 reads per million, 1 experiments
AAUCCAAUGCUCUUUCCACCAcaccacccUUGGGAUAGAGCAGAGGGUAGA
.((((..(((((((((((............))))).))))))..))))...

Structure
--A    AA      -     CCAca 
   AUCC  UGCUCU UUCCA     c
   ||||  |||||| |||||      
   UGGG  ACGAGA AGGGU     c
AGA    AG      U     Uccca 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 279202650-279202700 [-]

Database links

Mature mdo-miR-7266-5p

Accession MIMAT0028500
Description Monodelphis domestica mdo-miR-7266-5p mature miRNA
Sequence 1 - AAUCCAAUGCUCUUUCCACCA - 21
Evidence experimental
Illumina [1]

Mature mdo-miR-7266-3p

Accession MIMAT0028501
Description Monodelphis domestica mdo-miR-7266-3p mature miRNA
Sequence 30 - UUGGGAUAGAGCAGAGGGUAGA - 51
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45