miRBase entry: mdo-mir-219-2

Stem-loop mdo-mir-219-2


Accession
MI0023783
Description
Monodelphis domestica mdo-mir-219-2 precursor miRNA


Sequence

2583 reads, 95 reads per million, 2 experiments
UGAUUGUCCAAACGCAAUUCUcguggcuccggcccucgagAGUUGGGUCUGGACAUCCCG
.(((.(((((.((.(((((((((.(((....)))..))))))))).)).))))))))...

Structure
--U   U     A  G         -u   u 
   GAU GUCCA AC CAAUUCUcg  ggc c
   ||| ||||| || |||||||||  |||  
   CUA CAGGU UG GUUGAgagc  ccg c
GCC   -     C  G         uc   g 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr2: 270698645-270698704 [+]

Database links

Mature mdo-miR-219-5p

Accession MIMAT0004134
Description Monodelphis domestica mdo-miR-219-5p mature miRNA
Sequence 1 - UGAUUGUCCAAACGCAAUUCU - 21
Evidence experimental
Illumina [1]

Mature mdo-miR-219-2-3p

Accession MIMAT0031109
Description Monodelphis domestica mdo-miR-219-2-3p mature miRNA
Sequence 41 - AGUUGGGUCUGGACAUCCCG - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45