miRBase entry: mdo-mir-7380

Stem-loop mdo-mir-7380


Accession
MI0023966
Description
Monodelphis domestica mdo-mir-7380 precursor miRNA


Sequence

4986 reads, 74 reads per million, 5 experiments
AGGUCCCAGCUCUACUCCUCAUagaaagcuucgucacuCAGGAGUAAUGACGGGACCUGA
(((((((..(..(((((((....((........))....)))))))..)..)))))))..

Structure
--       AG UC       CAUa  aag 
  AGGUCCC  C  UACUCCU    ga   c
  |||||||  |  |||||||    ||    
  UCCAGGG  G  AUGAGGA    cu   u
AG       CA UA       Cuca  gcu 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chrX: 67721626-67721685 [-]

Database links

Mature mdo-miR-7380-5p

Accession MIMAT0028816
Description Monodelphis domestica mdo-miR-7380-5p mature miRNA
Sequence 1 - AGGUCCCAGCUCUACUCCUCAU - 22
Evidence experimental
Illumina [1]

Mature mdo-miR-7380-3p

Accession MIMAT0028817
Description Monodelphis domestica mdo-miR-7380-3p mature miRNA
Sequence 39 - CAGGAGUAAUGACGGGACCUGA - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23034410
    Birth and expression evolution of mammalian microRNA genes
    "Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H"
    "Genome Res (2013) 23:34-45