miRBase entry: ipu-mir-457b

Stem-loop ipu-mir-457b


Accession
MI0024713
Description
Ictalurus punctatus ipu-mir-457b precursor miRNA

Literature search
1 open access papers mention ipu-mir-457b
(2 sentences)

Sequence


UAGCAGCACAUCAAUAUUGGCAgcugcccucucccuggguugccaguauguuuugugcugcuccu
.(((((((((...(((((((((...((((.......)))))))))))))....)))))))))...

Structure
--U         -UCA         gcu    uc 
   AGCAGCACA    AUAUUGGCA   gccc  u
   |||||||||    |||||||||   ||||  c
   ucgucgugu    uaugaccgu   uggg  c
ucc         uuug         ---    uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature ipu-miR-457b

Accession MIMAT0029577
Description Ictalurus punctatus ipu-miR-457b mature miRNA
Sequence 1 - UAGCAGCACAUCAAUAUUGGCA - 22
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23342099
    Identification and characterization of microRNAs in channel catfish (Ictalurus punctatus) by using Solexa sequencing technology
    Xu Z, Chen J, Li X, Ge J, Pan J, Xu X
    PLoS One (2013) 8:e54174