miRBase entry: bdi-MIR7720

Stem-loop bdi-MIR7720


Accession
MI0025332
Description
Brachypodium distachyon bdi-MIR7720 precursor miRNA


Sequence


gucgugggggcaauuUCGAAAUUGAUCGUGCGGAGAAGCcucagaaacugcucgagaccgguuucucguaggaacccUUUUACACAUGAUUUGGGUUGGACcucuaguagca
((..((((((....(((((....(((((((.(..((((((((((((((((........)))))))).).)))....))))..).)))))))....)))))))))))...)).

Structure
-  -cg      caau     AAUU       C GA    ----   - -        cuc 
 gu   uggggg    uUCGA    GAUCGUG G  GAAG    Ccu c agaaacug   g
 ||   ||||||    |||||    ||||||| |  ||||    ||| | ||||||||    
 cg   aucucC    AGGUU    UUAGUAC C  UUUc    gga g ucuuuggc   a
a  aug      ----     GGGU       A AU    ccaa   u c        cag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
5: 17999321-17999432 [-]

Database links

Mature bdi-miR7720-5p

Accession MIMAT0030164
Description Brachypodium distachyon bdi-miR7720-5p mature miRNA
Sequence 16 - UCGAAAUUGAUCGUGCGGAGAAGC - 39
Evidence experimental
Illumina [1]

Mature bdi-miR7720-3p

Accession MIMAT0030165
Description Brachypodium distachyon bdi-miR7720-3p mature miRNA
Sequence 78 - UUUUACACAUGAUUUGGGUUGGAC - 101
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23264558
    Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon
    "Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E"
    "Mol Plant (2013) 6:423-443