miRBase entry: bta-mir-664b

Stem-loop bta-mir-664b


Accession
MI0025533
Description
Bos taurus bta-mir-664b precursor miRNA

Literature search
3 open access papers mention bta-mir-664b
(3 sentences)

Sequence

1415 reads, 34 reads per million, 73 experiments
caggcuaggagaaaugauuggauagaaaauuuuauucUAUUCAUUUAUCUCCCAGCCUAC
.(((((.(((((..(((.(((((((((.......))))))))).)))))))).)))))..

Structure
-c     a     aa   u         aa 
  aggcu ggaga  uga uggauagaa  u
  ||||| |||||  ||| |||||||||  u
  UCCGA CCUCU  AUU ACUUAUcuu  u
CA     C     --   U         au 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 24479316-24479375 [-]

Database links

Mature bta-miR-664b

Accession MIMAT0030438
Description Bos taurus bta-miR-664b mature miRNA
Sequence 38 - UAUUCAUUUAUCUCCCAGCCUAC - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 23472090
    Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection
    Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ
    PLoS One (2013) 8:e57543