MIR8485 is a microRNA (miRNA) that has been identified as one of the top three miRNAs related to the variance in mRNA expression between adult sham animals and young ones, suggesting a potential role in age-related molecular changes [PMC9748408]. In the context of cancer, MIR8485 is among the miRNAs found in exosomes derived from HCC827 cells that target genes within the p53 signaling pathway, which is crucial for cell cycle regulation and apoptosis [PMC9192438]. Mutations in MIR8485 have been associated with neurodegenerative processes through overexpression of neurexin 1 (NRXN1), which leads to presynaptic Ca2+ overload and mitochondrial dysfunction [PMC10014574]. Additionally, MIR8485 has been shown to influence autophagy by binding to LAMTOR3, subsequently reducing mTOR expression and enhancing autophagy markers ATG13 and LC3-II [PMC10102359]. This miRNA also appears among a list of 11 ranked miRNAs analyzed for target genes across the human genome, indicating its significance in gene regulation [PMC9338837].
ucugugau -auauagcaua auaca auacgugugugugugugugu ugugu u |||||||||||||||||||| ||||| UAUGCACACACACACACACA acaca a -------- Cacacacacac cacac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0033692 |
Description | Homo sapiens hsa-miR-8485 mature miRNA |
Sequence | 71 - CACACACACACACACACGUAU - 91 |
Evidence |
experimental
RT-PCR [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
|