MIR8485 is a non-coding RNA (ncRNA) that has been implicated in various biological processes and diseases [PMC9748408]. It has been identified as one of the top miRNAs associated with the number of mRNAs differing between adult and young animals [PMC9748408]. Additionally, MIR8485 has been found to be present in exosomes derived from HCC827 cells and is involved in the regulation of genes in the p53 signaling pathway [PMC9192438]. Mutations in MIR8485 have been linked to overexpression of neurexin 1 (NRXN1) and subsequent neurodegeneration [PMC10014574]. Furthermore, MIR8485 has been shown to bind to LAMTOR3, leading to modulation of mTOR expression and autophagy-related gene expression [PMC10102359]. In a search for miRNA targets, MIR8485 was among the 11 ranked miRNAs investigated for their potential targets among the human genome [PMC9338837].
ucugugau -auauagcaua auaca auacgugugugugugugugu ugugu u |||||||||||||||||||| ||||| UAUGCACACACACACACACA acaca a -------- Cacacacacac cacac
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0033692 |
Description | Homo sapiens hsa-miR-8485 mature miRNA |
Sequence | 71 - CACACACACACACACACGUAU - 91 |
Evidence |
experimental
RT-PCR [1] |
Database links | |
Predicted targets |
|