miRBase entry: pxy-mir-8521b-1

Stem-loop pxy-mir-8521b-1


Accession
MI0027351
Description
Plutella xylostella pxy-mir-8521b-1 precursor miRNA


Sequence

54 reads, 1692 reads per million, 4 experiments
cucuggcgcggcagucagaauucgggacgugcccggagcgguggCUUGUCCCGAAUUUUGACUCGGCCaaau
...((((.((..(((((((((((((((((.((((......).))).)))))))))))))))))))))))...

Structure
cuc    g  gc                 u   - gg 
   uggc cg  agucagaauucgggacg gcc c  a
   |||| ||  ||||||||||||||||| ||| |   
   aCCG GC  UCAGUUUUAAGCCCUGU Cgg g  g
uaa    -  --                 U   u gc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
scaffold_127: 936871-936942 [+]
Clustered miRNAs
7 other miRNAs are < 10 kb from pxy-mir-8521b-1
Name Accession Chromosome Start End Strand Confidence




Database links

Mature pxy-miR-8521b

Accession MIMAT0033751
Description Plutella xylostella pxy-miR-8521b mature miRNA
Sequence 45 - CUUGUCCCGAAUUUUGACUCGGCC - 68
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 24236051
    Identification and developmental profiling of microRNAs in diamondback moth, Plutellaxylostella (L.)
    Liang P, Feng B, Zhou X, Gao X
    PLoS One (2013) 8:e78787