miRBase entry: mse-mir-9570

Stem-loop mse-mir-9570


Accession
MI0029323
Description
Manduca sexta mse-mir-9570 precursor miRNA


Sequence


auggagcgguguugcgcuuuaugaaucggugucaauuuauauuauauguuuacaucacauaAUAUAUUGAUUCCGAUACACAAGgcgcggcagaugccgucg
.....(((((((((((((((.((.(((((.(((((..((((((((.((.......)).))))))))))))).))))).)).))))))))))....)))))..

Structure
augga     ----          a  a     u     uu        a  uu 
     gcggu    guugcgcuuu ug aucgg gucaa  uauauuau ug  u
     |||||    |||||||||| || ||||| |||||  |||||||| ||  a
     ugccg    cggcgcgGAA AC UAGCC UAGUU  AUAUAaua ac  c
---gc     uaga          C  A     U     --        c  ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
AIXA01020508.1: 1560-1661 [-]

Database links

Mature mse-miR-9570

Accession MIMAT0035706
Description Manduca sexta mse-miR-9570 mature miRNA
Sequence 62 - AUAUAUUGAUUCCGAUACACAAG - 84
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 24508515
    Identification of conserved and novel microRNAs in Manduca sexta and their possible roles in the expression regulation of immunity-related genes
    "Zhang X, Zheng Y, Jagadeeswaran G, Ren R, Sunkar R, Jiang H"
    "Insect Biochem Mol Biol (2014) 47:12-22