miRBase entry: gma-MIR9736

Stem-loop gma-MIR9736


Accession
MI0031018
Description
Glycine max gma-MIR9736 precursor miRNA


Sequence


aagguccccaccuuuguuuaucuuucaucccucauuauccucaaguuguccacaaucaugcuuaucuuucacccuuuugaggauauuggaugaUGAAAGACAAACAAAGGUGGGaacaa
...((.(((((((((((((.(((((((((..(((.((((((((((..............................)))))))))).)))..))))))))).))))))))))))).))..

Structure
aag  c             a         cc   u          uuguccacaaucau 
   gu cccaccuuuguuu ucuuucauc  uca uauccucaag              g
   || ||||||||||||| |||||||||  ||| ||||||||||               
   ca GGGUGGAAACAAA AGAAAGUag  ggu auaggaguuu              c
-aa  a             C         ua   u          ucccacuuucuauu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 46142093-46142211 [+]

Database links

Mature gma-miR9736

Accession MIMAT0036356
Description Glycine max gma-miR9736 mature miRNA
Sequence 94 - UGAAAGACAAACAAAGGUGGG - 114
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153