miRBase entry: gma-MIR9764

Stem-loop gma-MIR9764


Accession
MI0031063
Description
Glycine max gma-MIR9764 precursor miRNA


Sequence


uaaaaugagaaaguuaguguguauccacucuugauuugaauuauccauuucaaaucaagggUGGAUACACUCUUACUUUCUCucuuu
......((((((((.((.((((((((((((((((((((((........)))))))))))))))))))))).)).)))))))).....

Structure
uaaaau        u  u                      uua 
      gagaaagu ag guguauccacucuugauuugaa   u
      |||||||| || ||||||||||||||||||||||    
      CUCUUUCA UC CACAUAGGUgggaacuaaacuu   c
-uuucu        U  U                      uac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 34615857-34615943 [+]

Database links

Mature gma-miR9764

Accession MIMAT0036401
Description Glycine max gma-miR9764 mature miRNA
Sequence 62 - UGGAUACACUCUUACUUUCUC - 82
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 24475082
    Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
    Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
    PLoS One (2014) 9:e86153