miRBase entry: tch-mir-455

Stem-loop tch-mir-455


Accession
MI0031277
Description
Tupaia chinensis tch-mir-455 precursor miRNA


Sequence


uaugugccuuuggacuacaucgugggagccagcaccauGCAGUCCAUGGGCAUAUACACU
(((((((((.((((((.(((.(((........))).))).)))))).)))))))))....

Structure
----         u      a   c   gga 
    uaugugccu uggacu cau gug   g
    ||||||||| |||||| ||| |||    
    AUAUACGGG ACCUGA Gua cac   c
UCAC         U      C   c   gac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
KB320489.1: 5301569-5301628 [+]

Database links

Mature tch-miR-455-3p

Accession MIMAT0036608
Description Tupaia chinensis tch-miR-455-3p mature miRNA
Sequence 39 - GCAGUCCAUGGGCAUAUACACU - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 24314655
    microRNA expression in hepatitis B virus infected primary treeshrew hepatocytes and the independence of intracellular miR-122 level for de novo HBV infection in culture
    "Xu G, Gao Z, He W, Ma Y, Feng X, Cai T, Lu F, Liu L, Li W"
    "Virology (2014) 448:247-254