miRBase entry: bta-mir-2285as-2

Stem-loop bta-mir-2285as-2


Accession
MI0038162
Description
Bos taurus bta-mir-2285as-2 precursor miRNA

Literature search
11 open access papers mention bta-mir-2285as-2
(15 sentences)

Sequence

4 reads, 1 reads per million, 4 experiments
aaaacauucauuugaauuuuuccauaacaucagauggaAAGCCCUGAAUGAACUUUUUGG
((((..((((((((...((((((((........))))))))...))))))))..))))..

Structure
--    ca        aau        aac 
  aaaa  uucauuug   uuuuccau   a
  ||||  ||||||||   ||||||||    
  UUUU  AAGUAAGU   GAAaggua   u
GG    UC        CCC        gac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 83334799-83334858 [+]

Database links

Mature bta-miR-2285as

Accession MIMAT0046338
Description Bos taurus bta-miR-2285as mature miRNA
Sequence 39 - AAGCCCUGAAUGAACUUUUUGG - 60
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 27100870
    Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells
    Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM
    PLoS One (2016) 11:e0154129