miRBase entry: bta-mir-2285bf-3

Stem-loop bta-mir-2285bf-3


Accession
MI0038208
Description
Bos taurus bta-mir-2285bf-3 precursor miRNA

Literature search
11 open access papers mention bta-mir-2285bf-3
(15 sentences)

Sequence

173 reads, 2 reads per million, 30 experiments
aaacguucguucagguuuuucuagaauauuuugcaggAAAACACGAACAAACUUUUUG
....(((.((((..((((((((..((....))..))))))))..)))).)))......

Structure
--aaac   c    ag        ag  u 
      guu guuc  guuuuucu  aa a
      ||| ||||  ||||||||  ||  
      CAA CAAG  CAAAAgga  uu u
GUUUUU   A    CA        cg  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature bta-miR-2285bf

Accession MIMAT0046382
Description Bos taurus bta-miR-2285bf mature miRNA
Sequence 38 - AAAACACGAACAAACUUUUUG - 58
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 27100870
    Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells
    Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM
    PLoS One (2016) 11:e0154129