miRBase entry: bta-mir-2285bg

Stem-loop bta-mir-2285bg


Accession
MI0038210
Description
Bos taurus bta-mir-2285bg precursor miRNA

Literature search
11 open access papers mention bta-mir-2285bg
(15 sentences)

Sequence

5 reads, 1 reads per million, 5 experiments
aaaaguuugcuuggguuuuucuguaagauguuacaggggAAACCCGAACGAACUUUUUG
(((((((((.((((((((((((((((....))))).))))))))))).)))))))))..

Structure
--         c           -     g 
  aaaaguuug uuggguuuuuc uguaa a
  ||||||||| ||||||||||| |||||  
  UUUUCAAGC AGCCCAAAggg acauu u
GU         A           g     g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 36341603-36341661 [+]

Database links

Mature bta-miR-2285bg

Accession MIMAT0046386
Description Bos taurus bta-miR-2285bg mature miRNA
Sequence 40 - AAACCCGAACGAACUUUUUG - 59
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 27100870
    Comparative Analysis of the miRNome of Bovine Milk Fat, Whey and Cells
    Li R, Dudemaine PL, Zhao X, Lei C, Ibeagha-Awemu EM
    PLoS One (2016) 11:e0154129