miRBase entry: cpo-mir-92a-2

Stem-loop cpo-mir-92a-2


Accession
MI0038604
Description
Cavia porcellus cpo-mir-92a-2 precursor miRNA


Sequence


GGGUGGGGAUUUGUUGCAUUACUuguauuauauguaaagUAUUGCACUUGUCCCGGCCUGU
((((.(((((..((.(((.(((((.(((.....)))))))).)))))..))))).))))..

Structure
--    G     UU  U   U     g   u 
  GGGU GGGAU  GU GCA UACUu uau a
  |||| |||||  || ||| ||||| ||| u
  UCCG CCCUG  CA CGU AUgaa aug a
UG    G     UU  -   U     -   u 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
DS562983.1: 2512411-2512471 [-]
Clustered miRNAs
5 other miRNAs are < 10 kb from cpo-mir-92a-2
Name Accession Chromosome Start End Strand Confidence




Database links

Mature cpo-miR-92a-3p

Accession MIMAT0046929
Description Cavia porcellus cpo-miR-92a-3p mature miRNA
Sequence 40 - UAUUGCACUUGUCCCGGCCUGU - 61
Evidence experimental
Illumina [1]

Mature cpo-miR-92a-2-5p

Accession MIMAT0046930
Description Cavia porcellus cpo-miR-92a-2-5p mature miRNA
Sequence 1 - GGGUGGGGAUUUGUUGCAUUACU - 23
Evidence not_experimental

References

  1. PubMed ID: 26733575
    The Interrelationships of Placental Mammals and the Limits of Phylogenetic Inference
    "Tarver JE, Dos Reis M, Mirarab S, Moran RJ, Parker S, O'Reilly JE, King BL, O'Connell MJ, Asher RJ, Warnow T, Peterson KJ, Donoghue PC, Pisani D"
    "Genome Biol Evol (2016) 8:330-344