miRBase entry: mle-mir-1993

Stem-loop mle-mir-1993


Accession
MI0039598
Description
Melibe leonina mle-mir-1993 precursor miRNA


Sequence


UCGGGAAUAUCGGCAUAAUGCAgucuuccucaauaugcgUAUUAUGCUGCUAUUCACGAGA
(((.(((((.(((((((((((.((.(........).))))))))))))).))))).)))..

Structure
--   G     U           A  c ucc 
  UCG GAAUA CGGCAUAAUGC gu u   u
  ||| ||||| ||||||||||| || |    
  AGC CUUAU GUCGUAUUAUg cg a   c
AG   A     C           -  u uaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
Unknown

Database links

Mature mle-miR-1993-5p

Accession MIMAT0048819
Description Melibe leonina mle-miR-1993-5p mature miRNA
Sequence 1 - UCGGGAAUAUCGGCAUAAUGCA - 22
Evidence experimental
Illumina [1]

Mature mle-miR-1993-3p

Accession MIMAT0048820
Description Melibe leonina mle-miR-1993-3p mature miRNA
Sequence 40 - UAUUAUGCUGCUAUUCACGAGA - 61
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 26473382
    A Uniform System for the Annotation of Vertebrate microRNA Genes and the Evolution of the Human microRNAome
    "Fromm B, Billipp T, Peck LE, Johansen M, Tarver JE, King BL, Newcomb JM, Sempere LF, Flatmark K, Hovig E, Peterson KJ"
    "Annu Rev Genet (2015) 49:213-242