Mature hsa-miR-29b-3p
| Accession | MIMAT0000100 |
| Description | hsa-miR-29b-3p mature miRNA |
| Hairpins | |
| Sequence | UAGCACCAUUUGAAAUCAGUGUU |
| Evidence |
experimental
cloned [1-4], Northern [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0001960 negative regulation of cytokine-mediated signaling pathway |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23729669 | has_input UniProtKB:P24001 |
| acts_upstream_of | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23729669 | has_input UniProtKB:Q8IU54 |
| acts_upstream_of | GO:0034345 negative regulation of type III interferon production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23729669 | has_input UniProtKB:Q8IU54 |
| acts_upstream_of | GO:0045669 positive regulation of osteoblast differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| acts_upstream_of | GO:0060306 regulation of membrane repolarization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31553627 | occurs_in CL:0002591 |
| acts_upstream_of | GO:1902430 negative regulation of amyloid-beta formation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18434550 | |
| acts_upstream_of | GO:1902992 negative regulation of amyloid precursor protein catabolic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18434550 | |
| acts_upstream_of_or_within | GO:0098586 cellular response to virus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23729669 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18434550 | |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23729669 | has_input UniProtKB:P24001 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31553627 | has_input UniProtKB:P22460 |
| enables | GO:0106222 lncRNA binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31694982 | |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:17404574 | has_input UniProtKB:Q07820 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:18434550 | has_input UniProtKB:P56817 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19850741 | has_input UniProtKB:Q00534 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19850741 | has_input UniProtKB:Q07820 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19850741 | has_input UniProtKB:Q8NFU7 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19913496 | has_input UniProtKB:P02452 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19913496 | has_input UniProtKB:P08047 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19956414 | has_input UniProtKB:O43184 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19956414 | has_input UniProtKB:P13497 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:19956414 | has_input UniProtKB:Q9NYR9 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20041405 | has_input UniProtKB:P10415 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20041405 | has_input UniProtKB:Q07820 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20479936 | has_input UniProtKB:P28799 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
