Mature hsa-miR-132-3p
| Accession | MIMAT0000426 |
| Description | hsa-miR-132-3p mature miRNA |
| Hairpins | |
| Sequence | UAACAGUCUACAGCCAUGGUCG |
| Evidence |
experimental
cloned [2-3] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20190813 | has_input UniProtKB:P38936 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q13480 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28065883 | has_input UniProtKB:P20936 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P29475 |
| involved_in | GO:0008284 positive regulation of cell population proliferation |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21868695 | occurs_in CL:0000669 |
| involved_in | GO:0010575 positive regulation of vascular endothelial growth factor production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0010628 positive regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P10493 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P04275 |
| involved_in | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P35590 |
| involved_in | GO:0031393 negative regulation of prostaglandin biosynthetic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0032691 negative regulation of interleukin-1 beta production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0032720 negative regulation of tumor necrosis factor production |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0033137 negative regulation of peptidyl-serine phosphorylation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P10636 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21868695 | has_input UniProtKB:P20936 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:P17948 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25217442 | has_input UniProtKB:Q13480 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28065883 | has_input UniProtKB:P20936 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | has_input UniProtKB:P29475 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:20190813 | has_input UniProtKB:P38936 |
| involved_in | GO:0045019 negative regulation of nitric oxide biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | occurs_in CL:0000540 |
| involved_in | GO:0045766 positive regulation of angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:21868695 | occurs_in CL:0000071 |
| involved_in | GO:0051771 negative regulation of nitric-oxide synthase biosynthetic process |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
| involved_in | GO:0051771 negative regulation of nitric-oxide synthase biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:28089352 | occurs_in CL:0000540 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
