Mature hsa-miR-142-3p
| Accession | MIMAT0000434 |
| Description | hsa-miR-142-3p mature miRNA |
| Hairpins | |
| Sequence | UGUAGUGUUUCCUACUUUAUGGA |
| Evidence |
experimental
cloned [2-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032690 negative regulation of interleukin-1 alpha production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22870299 | occurs_in CL:0000312 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22870299 | has_input UniProtKB:P01583 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24558198 | has_input UniProtKB:P36897 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31168355 | has_input UniProtKB:Q99717 |
| involved_in | GO:0030512 negative regulation of transforming growth factor beta receptor signaling pathway |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24558198 | has_input UniProtKB:P36897 |
| involved_in | GO:0032496 response to lipopolysaccharide |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:28100738 | occurs_in UBERON:0002037 |
| involved_in | GO:0034612 response to tumor necrosis factor |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:28100738 | occurs_in UBERON:0002037 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22870299 | has_input UniProtKB:P01583 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24558198 | has_input UniProtKB:P36897 |
| involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31168355 | has_input UniProtKB:Q99717 |
| involved_in | GO:0050728 negative regulation of inflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:22870299 | occurs_in CL:0000312 |
| involved_in | GO:0051966 regulation of synaptic transmission, glutamatergic |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:28100738 | occurs_in UBERON:0002037 |
| involved_in | GO:0051966 regulation of synaptic transmission, glutamatergic |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:28100738 | |
| involved_in | GO:0061890 positive regulation of astrocyte activation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0000956 |
| involved_in | GO:0070555 response to interleukin-1 |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:28100738 | occurs_in UBERON:0002037 |
| involved_in | GO:0071560 cellular response to transforming growth factor beta stimulus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24558198 | has_input UniProtKB:P01137 |
| involved_in | GO:0150078 positive regulation of neuroinflammatory response |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0000956 |
| involved_in | GO:0150078 positive regulation of neuroinflammatory response |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:28100738 | |
| involved_in | GO:1903980 positive regulation of microglial cell activation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in UBERON:0000956 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:18766170 | part_of UBERON:0001969 |
| located_in | GO:0005615 extracellular space |
ECO:0007005 high throughput direct assay evidence used in manual assertion |
PMID:26646931 | part_of UBERON:0001969 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
miR2Disease
A manually curated database, aimed at providing a comprehensive resource of miRNA deregulation in various human diseases.
Click here for more information and to obtain references for the studies.
| Disease | Differential expression | Experiment | Year | Study |
|---|
