Mature mmu-let-7e-5p
| Accession | MIMAT0000524 |
| Description | mmu-let-7e-5p mature miRNA |
| Hairpins | |
| Sequence | UGAGGUAGGAGGUUGUAUAGUU |
| Evidence |
experimental
cloned [1-4], Illumina [5,7] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24503540 | has_input UniProtKB:P41245 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24503540 | has_input UniProtKB:P41245 |
| involved_in | GO:0072108 positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24503540 | occurs_in CL:0002570 |
| involved_in | GO:1905049 negative regulation of metallopeptidase activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:24503540 | occurs_in CL:0002570 |
| involved_in | GO:2000698 positive regulation of epithelial cell differentiation involved in kidney development |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:24503540 | occurs_in CL:0002570 |
