Mature mmu-miR-26a-5p
| Accession | MIMAT0000533 |
| Description | mmu-miR-26a-5p mature miRNA |
| Hairpins | |
| Sequence | UUCAAGUAAUCCAGGAUAGGCU |
| Evidence |
experimental
cloned [1-2,4-5], Illumina [6,8] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25766405 | has_input UniProtKB:Q05306 |
| involved_in | GO:0010459 negative regulation of heart rate |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23543060 | |
| involved_in | GO:0032286 central nervous system myelin maintenance |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25362566 | occurs_in UBERON:0002240 |
| involved_in | GO:0032700 negative regulation of interleukin-17 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25362566 | occurs_in UBERON:0000955 |
| involved_in | GO:0032715 negative regulation of interleukin-6 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25362566 | occurs_in UBERON:0000955 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23543060 | has_input UniProtKB:P35561 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25766405 | has_input UniProtKB:Q05306 |
| involved_in | GO:0060371 regulation of atrial cardiac muscle cell membrane depolarization |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23543060 | |
| involved_in | GO:0090370 negative regulation of cholesterol efflux |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:22673513 | occurs_in CL:0000235 |
| involved_in | GO:0150079 negative regulation of neuroinflammatory response |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:25362566 | occurs_in UBERON:0002240 |
| involved_in | GO:1903609 negative regulation of inward rectifier potassium channel activity |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:23543060 | occurs_in CL:0002129 |
