Accession | MIMAT0000609 |
Description | mmu-miR-351-5p mature miRNA |
Hairpins | |
Sequence | UCCCUGAGGAGCCCUUUGAGCCUG |
Evidence |
experimental
cloned [1], Illumina [2,4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26505789 | has_input UniProtKB:P42227 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26505789 | occurs_in CL:0010006 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26505789 | has_input UniProtKB:P42227 |
involved_in | GO:1905563 negative regulation of vascular endothelial cell proliferation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26505789 | acts_on_population_of CL:0010006 |
involved_in | GO:2000353 positive regulation of endothelial cell apoptotic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26505789 | occurs_in CL:0010008 |