Mature hsa-miR-573
| Accession | MIMAT0003238 |
| Description | hsa-miR-573 mature miRNA |
| Hairpins | |
| Sequence | CUGAAGUGAUGUGUAACUGAUCAG |
| Evidence |
experimental
SAGE [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0010719 negative regulation of epithelial to mesenchymal transition |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26451614 | |
| acts_upstream_of | GO:0040037 negative regulation of fibroblast growth factor receptor signaling pathway |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:26451614 | has_input UniProtKB:P11362 |
| acts_upstream_of_or_within | GO:0010629 negative regulation of gene expression |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26451614 | has_output UniProtKB:P40763 |
| enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26451614 | has_input UniProtKB:P11362 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26451614 | has_input UniProtKB:P11362 |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26451614 | has_input UniProtKB:P11362 |
