Mature mmu-miR-495-3p
| Accession | MIMAT0003456 |
| Description | mmu-miR-495-3p mature miRNA |
| Hairpins | |
| Sequence | AAACAAACAUGGUGCACUUCUU |
| Evidence |
experimental
MPSS [1], cloned [2], Illumina [3-4] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:1903671 negative regulation of sprouting angiogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25085941 | occurs_in UBERON:0001389 |
| involved_in | GO:1905652 negative regulation of artery morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:25085941 |
