Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: mdo-let-7g-5p
Mature
mdo-let-7g-5p
Accession
MIMAT0004142
Description
mdo-let-7g-5p mature miRNA
Hairpins
mdo-let-7g
Sequence
UGAGGUAGUAGUUUGUACAGU
Copy Sequence
Evidence
experimental
Illumina [2]
Database links
Predicted targets