Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: cel-miR-253-3p
Mature
cel-miR-253-3p
Accession
MIMAT0004215
Description
cel-miR-253-3p mature miRNA
Hairpins
cel-mir-253
Sequence
UUAGUAGGCGUUGUGGGAAGGG
Copy Sequence
Evidence
experimental
cloned [2], Illumina [3,5], CLIPseq [4]
Database links
Predicted targets