Accession | MIMAT0004284 |
Description | hsa-miR-675-5p mature miRNA |
Hairpins | |
Sequence | UGGUGCGGAGAGGGCCCACAGUG |
Evidence |
experimental
cloned [1] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
acts_upstream_of | GO:0051897 positive regulation of phosphatidylinositol 3-kinase/protein kinase B signal transduction |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31574452 | occurs_in CL:0000182 |
acts_upstream_of | GO:1900017 positive regulation of cytokine production involved in inflammatory response |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31574452 | has_input UniProtKB:P01579 |
acts_upstream_of | GO:1903428 positive regulation of reactive oxygen species biosynthetic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31574452 | occurs_in CL:0000182 |
acts_upstream_of | GO:1903945 positive regulation of hepatocyte apoptotic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31574452 | |
acts_upstream_of | GO:2000378 negative regulation of reactive oxygen species metabolic process |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31574452 | occurs_in CL:0000182 |
acts_upstream_of | GO:2001170 negative regulation of ATP biosynthetic process |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31574452 | occurs_in CL:0000182 |
enables | GO:0003730 mRNA 3'-UTR binding |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31574452 | has_input UniProtKB:Q07869 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | has_input UniProtKB:Q9NTI2 |
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31574452 | has_input UniProtKB:Q07869 |
involved_in | GO:0007162 negative regulation of cell adhesion |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | occurs_in CL:2000058 |
involved_in | GO:0033689 negative regulation of osteoblast proliferation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26891291 | has_input UniProtKB:Q9NTI2 |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:31574452 | has_input UniProtKB:Q07869 |
involved_in | GO:0045668 negative regulation of osteoblast differentiation |
ECO:0000250 sequence similarity evidence used in manual assertion |
PMID:GO_REF:0000024 | |
involved_in | GO:0098586 cellular response to virus |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:31574452 | occurs_in CL:0000182 |