Mature hsa-miR-100-3p
| Accession | MIMAT0004512 |
| Description | hsa-miR-100-3p mature miRNA |
| Hairpins | |
| Sequence | CAAGCUUGUAUCUAUAGGUAUG |
| Evidence |
experimental
cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| acts_upstream_of | GO:0032717 negative regulation of interleukin-8 production |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | occurs_in CL:0000650 |
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | has_input UniProtKB:P10145 |
| involved_in | GO:0035278 miRNA-mediated gene silencing by inhibition of translation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:27542871 | has_input UniProtKB:P10145 |
