Accession | MIMAT0004659 |
Description | mmu-miR-10a-3p mature miRNA |
Hairpins | |
Sequence | CAAAUUCGUAUCUAGGGGAAUA |
Evidence |
experimental
cloned [2], Illumina [3-4] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | has_input UniProtKB:P52927 |
involved_in | GO:0016525 negative regulation of angiogenesis |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | |
involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | has_input UniProtKB:P52927 |
involved_in | GO:0043537 negative regulation of blood vessel endothelial cell migration |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | |
involved_in | GO:0110059 negative regulation of blood vessel endothelial cell differentiation |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | |
involved_in | GO:1903769 negative regulation of cell proliferation in bone marrow |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | |
involved_in | GO:2000774 positive regulation of cellular senescence |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:23072816 | occurs_in CL:0002092 |