Mature dme-miR-1017-3p
| Accession | MIMAT0005030 |
| Description | dme-miR-1017-3p mature miRNA |
| Hairpins | |
| Sequence | GAAAGCUCUACCCAAACUCAUCC |
| Evidence |
experimental
454 [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:38048325 | |
| involved_in | GO:0032222 regulation of synaptic transmission, cholinergic |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:38048325 | |
| involved_in | GO:0035195 miRNA-mediated post-transcriptional gene silencing |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:38048325 |
