Mature hsa-miR-519b-5p
| Accession | MIMAT0005454 |
| Description | hsa-miR-519b-5p mature miRNA |
| Hairpins | |
| Sequence | CUCUAGAGGGAAGCGCUUUCUG |
| Evidence |
experimental
array-cloned [1], cloned [2] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| enables | GO:0003674 molecular_function |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 | |
| involved_in | GO:0008150 biological_process |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 | |
| is_active_in | GO:0005575 cellular_component |
ECO:0000307 no evidence data found used in manual assertion |
PMID:GO_REF:0000015 |
StarBase
MicroRNA-mRNA interaction maps from Argonaute CLIP-Seq and Degradome-Seq data.
| Target Gene ID | Target Gene Name | Number of supporting experiments | Number of target-predicting programs | Maximum number of target sites | Chromosome | Target-predicting region start | Target-predicting region end | Strand |
|---|
