Mature dme-miR-963-5p
| Accession | MIMAT0005477 |
| Description | dme-miR-963-5p mature miRNA |
| Hairpins | |
| Sequence | ACAAGGUAAAUAUCAGGUUGUUUC |
| Evidence |
experimental
454 [1] |
| Database links |
|
| Predicted targets |
|
QuickGo Function
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
| Qualifier | GO term | Evidence | Reference | Annotation Extension |
|---|---|---|---|---|
| involved_in | GO:0006955 immune response |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 | |
| involved_in | GO:0060259 regulation of feeding behavior |
ECO:0000316 genetic interaction evidence used in manual assertion |
PMID:23122660 |
