Home
(current)
Search
Browse
Help
Downloads
Home
(current)
Search
Browse
Help
Downloads
miRBase entry: cel-miR-42-5p
Mature
cel-miR-42-5p
Accession
MIMAT0015095
Description
cel-miR-42-5p mature miRNA
Hairpins
cel-mir-42
Sequence
GUGGGUGUUUGCUUUUUCGGUGAAG
Copy Sequence
Evidence
experimental
CLIPseq [7]
Database links